This document provides basic installation and operation instructions for 
fqtrim, a software utility for trimming and processing short DNA sequences
in FASTA or FASTQ format.

1.Installation

If you downloaded the binary package simply unpack and copy the fqtrim 
executable in a directory of your choice.

If you downloaded the source package, just unpack and run the 'make release'
command to build the fqtrim executable:

    tar xvfz fqtrim-N.NN.tar.gz
    cd fqtrim-N.NN
    make release

2. Notes

2.1 Adapter file format

The -f option expects a text file with the adapter sequences to be trimmed from the ends
of the reads. This file has a loose 2-column format, where columns are delimited by tab, space, 
comma, colon or semicolon characters ('\t', ' ', ';', ':' or ','). Adapter sequences to be trimmed
from the 5' end should be given in the first column, while the 3' end adapters are in the 2nd 
column. If only the 3' adapters are to be trimmed, the corresponding line should start 
with one of delimiter characters mentioned above. 

Example 1: 
If we want to trim the adapter sequence CGACAGGTTCAGAGTTCTACAGTCCGACGATC from the left (5') 
end of the reads and the sequence TCGTATGCCGTCTTCTGCTTG from the 3' end, the file would 
have a line like this:

CGACAGGTTCAGAGTTCTACAGTCCGACGATC TCGTATGCCGTCTTCTGCTTG

There is no relationship assumed between 5' and 3' adapter sequences if they are provided 
on the same line. The line above is equivalent to using 2 lines, one for each adapter sequence:

CGACAGGTTCAGAGTTCTACAGTCCGACGATC,
 TCGTATGCCGTCTTCTGCTTG

Note the space at the beginning of the line providing the 3' end adapter 
and the comma at the end of the first line. 
If, on the other hand, there were no delimiter at the end of the line, e.g.:

CGACAGGTTCAGAGTTCTACAGTCCGACGATC
,TCGTATGCCGTCTTCTGCTTG

..then the sequence on that line would be searched for at *both* ends of a read
(both 5' and 3'), while the sequence on the 2nd line in this case would only be 
searched at the 3' end, like before.

Example2: 
If only 3' adapter should be trimmed (e.g. the one from Example 1), 
the adapter file should have a line like this, starting with a delimiter character:

,TCGTATGCCGTCTTCTGCTTG