Skip to content

mmterpstra/DigitalBarcodeReadgroups

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

33 Commits
 
 
 
 
 
 
 
 

Repository files navigation

DigitalBarcodeReadgroups


Create readgroups from barcodes with random nucleotides incorporates into them for improving sequencing depth. The analysis for marking / removing duplicates does not handle random barcodes/UMIs (Unique Molecular Indentifiers) and should be modified to include random barcodes/UMIs in the analysis.

This is a git for noting down the steps using simple perl tools.

The following steps are performed

  1. Basecall to fastq
  2. Integrate the barcode into reads
  3. Trim off landing probes
  4. Align
  5. Add read group info
  6. Expand read group info
  7. Mark duplicates

Requirements

  • perl
  • an aligner eg. bwa-7.12/hisat2-2.0.4
  • picard-1.140 and up
  • this repo
  • pipeline-util
  • bedtools
  • samtools

Installing

Add the scr/ dir to your path.

notes

This is primairly used for the Nugene Ovation® Target Enrichment System. link

Basecalling


Use bcl to fastq from illumina. This is an example for questions and documentation see here. This is not a complete guide for more detailed install instructions visit the illumina website.

bcl2fastq 2 software install / run


Install bcltofastq(2)

mkdir -p source/bclToFastq2/
cd source/bclToFastq/; wget  ftp://webdata2:webdata2@ussd-ftp.illumina.com/downloads/software/bcl2fastq/bcl2fastq2-v2.17.1.14.tar.zip
unzip bcl2fastq2-v2.17.1.14.tar.zip
tar -zxf bcl2fastq2-v2.17.1.14.tar.gz
mv bcl2fastq bcl2fastq-v2.17.1.14
cd bcl2fastq-v2.17.1.14
mkdir -p install/bclToFastq/bcl2fastq-v2.17.1.14
./src/configure --prefix=install/bclToFastq/bcl2fastq-v2.17.1.14
make
make install

Run bcl2fastq. This is ran on a paired end run starting from the main run folder. Note the --use-bases-mask y*,i8y*,y* and the --minimum-trimmed-read-length 0 options.

  • --use-bases-mask y*,i8y*,y* will output the N6 random/UMI barcodes a second read. For Single End run only specify --use-bases-mask y*,i8y*.
  • --minimum-trimmed-read-length 0 this will prevent the bcl2fastq software from truncating your N6 barcodes/UMI into sequences of NNNNNN because the software is set by default to mask the cycles with N these when they are less then 22nt long. Note: this might even be set to 5 but did not test it.
  • In the Samplesheet.csv it's also advised to turn on the Illumina adapter trimming when running PE sequencing.

this code below is for running the analysis without adapter trimming

bcl2fastq \
 --sample-sheet SampleSheet.csv \
 -i Data/Intensities/BaseCalls/ \
 -R ./ \
 --intensities-dir Data/Intensities/ \
 -o Data/Intensities/BaseCalls/run2 \
 --use-bases-mask y*,i8y*,y* \
 --barcode-mismatches 1 \
 --minimum-trimmed-read-length 0 \
 --create-fastq-for-index-reads

With adapter trimming you should confirm the settings part contains the following adapter sequences.

[Settings]
Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
AdapterRead3,AGATCGGAAGAGCGTCGTGTAGGGAAAGA

Also you need to edit the bcl2fastq call to replace --minimum-trimmed-read-length 0 with --mask-short-adapter-reads 5 resulting into the command below.

bcl2fastq --sample-sheet SampleSheet.csv \
 -i Data/Intensities/BaseCalls/ \
 -R ./ \
 --intensities-dir Data/Intensities/ \
 -o Data/Intensities/BaseCalls/run8 \
 --use-bases-mask y*,i8y*,y* \
 --create-fastq-for-index-reads \
 --barcode-mismatches 1 \
 --mask-short-adapter-reads 5


install bcltofastq(1) depreciated

mkdir -p path/to/bclToFastq/
cd path/to/bclToFastq/; wget  ftp://webdata:webdata@ussd-ftp.illumina.com/Downloads/Software/bcl2fastq/bcl2fastq-1.8.4.tar.bz2
tar -jxf bcl2fastq-1.8.4.tar.bz2
mv bcl2fastq bcl2fastq-1.8.4
cd bcl2fastq-1.8.4
src/configure --prefix=/full/path/to/bclToFastq/bcl2fastq-1.8.4
make
make install

run bcltofastq on data the i8y6 part says to treat the random part as read2 and the paired ends as read1/3

##make makefiles #note first run without commands or without --use-bases-mask y151,i8y6,y151 to infer experiment
perl /full/path/to/bclToFastq/bcl2fastq-1.8.4/bin/configureBclToFastq.pl --output-dir /full/path/to/fastq --input-dir /full/path/to/basecalldir/Data/Intensities/BaseCalls --force --no-eamss --use-bases-mask y151,i8y6,y151 --sample-sheet /full/path/to/SampleSheetBclToFastq.csv --mismatches 1 &
#run makefiles with 12 cores in background
nohup make -C path/to/fastq -j 12&

Integrate the barcode into reads


For the in-house generated data from nugene use:

$perl -wpe 'if($. % 4 == 1 ){chomp; my @t =split(" "); my @hd= split(":",$t[0]); $hd[2] =  $hd[2] ."_" .$t[2]; $_=join(" ",(join(":", @hd), $t[1], $t[2]))."\n";}

When you have used bcltofastq. you can use these helper scripts from this github. Here are some examples.

perl NugeneMergeFastqFiles.pl  -q 20  randombc_R2.fq.gz outdir reads_R1.fastq.gz reads_R3.fastq.gz
perl NugeneMergeFastqFiles.pl   randombc_R2.fq.gz outdir reads_R1.fastq.gz

This will add the barcode to the flowcell ID(fcid) like "${fcid}_${barcode}"

Trim off landing probes


trim of landing probes using the bbduk.sh programme from the bbmap package. This is installed by downloading/extracting the data from the sourceforge project page. This also needs a probe sequence file 'probes_ET1262F_2_182.fasta' you can generate this using the supplied 'probes_ET1262F_2_182.bed' file and bedtools getfasta (versus ucsc genome). This is the advised config:

bbduk.sh in=in.fq.gz out=out.fq.gz ref=probes_ET1262F_2_182.fasta hdist=1 ktrim=r rcomp=f k=31 mink=11 qtrim=r trimq=20 minlen=20 

A better alternative is to use the probe mapping locations (probes.bed) with the read alignment to filter the landing probes. This step will need to have bedtools,samtools installed also see:pipeline-util and the trimByBed.pl script.

bwa mem ... reads_R1.fastq.gz > align.sam || hisat2 ... -U reads_R1.fastq.gz -S align.sam
trimByBed.pl -s align.sam  -b probe.bed  -o reads_R1.cleaned.fastq.gz
bbduk.sh in=in.fq.gz out=out.fq.gz qtrim=r trimq=20 minlen=20 

Align


Align with your favourite aligner storing the data in sam format for output data.

bwa-mem .... || hisat2 ...

Add read group info


Use AddOrReplaceReadGroups from the picard toolkit to add your readgroups.

java -Xmx6g -jar AddOrReplaceReadGroups.jar ...

Expand read group info


Add read group info for each barcode and reindex. This wil restore your fcid tag + create a readgroup for each random barcode with the correct sample.

perl NugeneDigitalSplitter.pl in.bam out.bam
java -Xmx6g -jar picard.jar BuildBamIndex INPUT=out.bam

Mark duplicates


This should work. Although the duplicate filtering might not be completely perfect because It does't take into account the Alignment distances of the different UMIs.

java -Xmx6g -jar picard.jar MarkDuplicates...

and now you can run the rest of your variant calling pipeline!

About

Create readgroups from barcodes with random nucleotides incorporates into them. This is a git for noting down the results.

Resources

License

Stars

2 stars

Watchers

1 watching

Forks

Packages

 
 
 

Contributors

Languages